[صفحه اصلی ]   [Archive] [ English ]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: تمام شماره‌ها :: ثبت نام :: تماس با ما ::
:: دوره 6، شماره 1 - ( بهار 1395 ) ::
جلد 6 شماره 1 صفحات 113-119 برگشت به فهرست نسخه ها
کلونینگ و بیان نواحی آنتیژنیک ژن CagA هلیکوباکتر پیلوری در باکتری اشرشیاکلی
مهدیه مالکی1، محمد رضا نصیری2، مجتبی طهمورث پور1، کیارش قزوینی3
1- گروه علوم دامی، دانشکده کشاورزی ،دانشگاه فردوسی مشهد، مشهد، ایران.
2- گروه علوم دامی، دانشکده کشاورزی ،دانشگاه فردوسی مشهد، مشهد، ایران. ، nassiryr@um.ac.ir
3- گروه میکروب شناسی، دانشکده علوم پزشکی، دانشگاه فردوسی مشهد، مشهد، ایران.
واژه‌های کلیدی: هلیکوباکتر پیلوری، ناحیه آنتی ژنیک، CagA، پروتئین نوترکیب
متن کامل [PDF 1120 kb]   (1945 دریافت)     |   چکیده (HTML)  (4462 مشاهده)
نوع مطالعه: پژوهشي | موضوع مقاله: بیوتکنولوژی پزشکی
دریافت: ۱۳۹۴/۸/۲۲ | پذیرش: ۱۳۹۴/۱۲/۱۰ | انتشار: ۱۳۹۵/۳/۲۸
متن کامل:   (2131 مشاهده)

مقدمه

هلیکو باکتر پیلوری (Helicobacter pylori) شایع‌ترین پاتوژن گوارشی است که انسان‌ها را در بعد جهانی مبتلا به عفونت ساخته است و بیش از نیمی از مردم دنیا آلوده به این باکتری هستند (1). این باکتری نوعی باکتری گرم منفی مارپیچی شکل و مهم‌ترین علت بیماری‌های معده‌ای-روده‌ای از جمله گاستریک مزمن، زخم معده و دوازدهه، سرطان معده و لنفوما است (2). بررسی‌های اپیدمیولوژی و آماری  عفونت مزمن هلیکوباکترپیلوری را با سرطان بدخیم معده مرتبط دانسته‌اند و این امر موجب شده که آژانس پژوهش سرطان سازمان بهداشت جهانی (WHO) این باکتری را در زمره‌ی عوامل سرطان زای کلاس I قرار دهد (3). بیش از 80% از افراد آلوده به این باکتری بدون علامت هستند و بدیهی است که ممکن است نقش مهمی را در اکولوژی طبیعی معده بازی کند (4). بیش از 50% جمعیت جهان H.پیلوری را در قسمت فوقانی دستگاه گوارش خود دارند. عفونت در کشور‌های در حال توسعه شایع تر است و بروز آن در کشور‌های غربی در حال کاهش است. تصور می‌شود شکل مارپیچ H.پیلوری (که از نام عمومی آن گرفته شده است) به منظور نفوذ به پوشش مخاطی معده تکامل یافته است (5 و 6). عفونت هلیکوباکترپیلوری در ایران نیز شایع بوده و به خصوص سرطان معده از آمار بالائی بر خوردار است. این سرطان که مسئول مرگ 65000 نفر در جهان در سال 2000 است، در مردها پس از سرطان ریه دومین عامل مرگ و میر ناشی از سرطان بوده و در مجموع حدود 10 درصد از کل مرگ و میر سالیانه سرطان را به خود اختصاص می‌دهد (7).  میزان عفونت  H.پیلوری در جمعیت اردبیل بالا و در حدود 89 درصد بوده است و یکی از بالاترین آمارهای جهان در رابطه با سرطان معده مربوط به استان اردبیل است که به تنهایی حدود یک سوم تمام موارد سرطان در اردبیل بین سال‌های 1996 تا 1999 مربوط به این سرطان بوده است (8). به علاوه بررسی‌ها در شهر شیراز نیز ابتلای 98-82 درصد کودکان بین 9 ماهه تا 10 ساله را به این باکتری نشان می‌دهد (3). عفونت هلیکوباکترپیلوری با لنفومای MALT و سرطان معده در ارتباط است و تصور می‌شود که CagA در گسترش سرطان  نقش داشته باشد (9). پروتئین  Cag A به وسیله ژن Cag A کد می‌شود که در انتهای جزایر بیماری زایی (pathogenicity island (PAI) واقع شده است که ژن آن حاوی 40 کیلو جفت باز با وزن معادل 140 کیلو‌ دالتون است و دارای قدرت ایمونوژنیسیته فراوان می‌باشد (10). در سال 2001 دانشمندان اعلام کردند که سویه‌هائی از هلیکوباکتر پیلوری که دارای ژن CagA هستند توانائی ایجاد زخم‌های طولانی را دارند (11). همچنین CagA یک پروتئین با خاصیت آنتی‌ژنیکی بسیار قوی است که با واکنش‌های برجسته‌ی التهابی تولید شده به وسیله‌ی ترشح اینترلوکین-8 در ارتباط است (12). چند عامل بیماری زائی در H.پیلوری وجود دارند که در ایجاد سرطان موثر شناخته شده‌اند و از جمله آن‌ها پروتئین CagA است (13). در سال 2010 کلیموویچ و همکاران به دنبال بررسی معرف‌های ایمنی برای تشخیص CagA هلیکوباکتر پیلوری اولین مجموعه از آنتی بادی‌های منوکلونال را بر علیه CagA تولید و مشخص کردند. آن‌ها همچنین بیان داشتند که استفاده از فن آوری پروتئین نوترکیب امکان به دست آوردن آنتی ژن خالص CagA را ایجاد کرده است (14). دانشمندان در سال 2012 ضمن اعلام این مطلب که عفونت مزمن با باکتری‌های گرم منفی هلیکوباکتر پیلوری یک عامل خطر عمده برای توسعه سرطان معده است بیان کردند که شواهد موجود نشان می‌دهد که ژن CagA (سیتوتوکسین مرتبط با ژن A) دارای یک نقش کلیدی آنکوژنیک در بیماری زائی هلیکوباکتر پیلوری است. آن‌ها اعلام کردند که برخی از فعالیت‌های بیولوژیکی CagA نیاز به فسفوریلاسیون تیروزین آن به وسیله کیناز‌های سلول میزبان دارند (15). به علاوه بررسی‌های اخیر نشان دهنده‌ی مقاومت نسبتا زیاد هلیکوباکترپیلوری به درمان‌های آنتی بیوتیکی است (16). در نتیجه درمان‌های اخیر در جهت به کارگیری درمان‌های اختصاصی و نوین برای مقابله با این عفونت است که در این میان پروتئین CagA که یکی از پروتئین‌های هلیکوباکتر پیلوری است هدف بالقوه مناسبی برای تولید آنتی بادی‌های اختصاصی به این منظور است.

در سال 2013 دانشمندان موفق به همسانه سازی زیر واحد CagA هلیکوباکتر پیلوری شدند و وجود خاصیت آنتی ژنیسیته پروتئین نوترکیب حاصل را اثبات کردند (17). هر چند کلونیگ زیر واحد CagA  با رویکرد تشخیصی و نه درمانی پیش از این نیز انجام شده است (18). اما با این حال تاکنون در ایران هیچ تحقیقی مبنی بر تولید پروتئین نوترکیب حاوی نواحی آنتی‌ژنیک زیر واحد CagA هلیکوباکتر پیلوری که در این تحقیق مدنظر ما بود، انجام نشده است.

مواد و روش‌ها

 تهیه باکتری هلیکوباکتر پیلوری

    نمونه‌های بیوپسی از معده 30 بیمار تحت درمان در بیمارستان قائم شهر مشهد که مشکوک به آلوده بودن به هلیکوباکتر پیلوری بودند جمع آوری و بر روی محیط کشت کلمبیا آگار در شرایط میکروآئرو فیلیک در دمای 37 درجه سانتی گراد به مدت 5 روز کشت داده شدند. تعیین هویت باکتری با تست اوره آز مورد تایید قرار گرفت و باکتری‌های رشد یافته به منظور استخراج DNA در فریزر 20-  درجه نگه‌داری شدند.

 استخراج DNA

استخراج DNA با استفاده از کیت شرکت Qiagen آلمان طبق دستور العمل مربوطه انجام شد. کمیت و کیفیت DNA استخراج شده با استفاده از اسپکتوفتومتر نانودراب (ND2000 Thermo) و الکتروفوروز ژل 1 درصد آگاروز تعیین شد. DNA به دست آمده جهت نگهداری به دمای 20- درجه سانتی‌گراد منتقل شد.

تعیین نواحی آنتی‌ژنیک ژن CagA

جهت تعیین نواحی آنتی‌ژنیک ژن CagA توالی ژن CagA با شماره دسترسی FJ798973 از بانک ژنی NCBI تهیه و با استفاده از نرم‌افزار‌های بیوانفورماتیکی زیر نواحی آنتی‌ژنیک این ژن تعیین شد.  

Antigeni (http://imed. med. ucm. es/Tools/antigenic. Pl)

Immuneepitope (http://tools.immuneepitope.org/tools/bcell/iedb_input)

Pepito (http://pepito. proteomics. ics. uci. Edu)

Bcepred Pl (http://www. imtech. res. in/cgibin/bcepred/bcepred)

طراحی آغازگرها و شبیه سازی کلونینگ

با استفاده از نرم افزار Primer primier5 دو جفت آغازگر اختصاصی و دنباله دار به منظور تکثیر نواحی آنتی‌ژنیک ژن CagA هلیکوباکتر پیلوری با توجه به همولوژی توالی‌ها طراحی گردید.

آغازگر رفت لینکر دار (5'CGCGGATCCATGGGCGTATTTGATGAATCCTTGA3')  برای آنزیم BamHI

آغازگر برگشت لینکردار (5'CCGGAATTCTTCTTGGAGGCGTTGGTATATTTGA3') برای آنزیم EcoRI

  پس از طراحی آغازگرها جهت شبیه سازی کلونینگ و بررسی چهارچوب صحیح ژن در ناقل pET32 از نرم افزار CLC Main Workbench 5 استفاده شد.

تکثیر ژن

PCR با استفاده از 50 نانوگرم از DNA الگو، µl 5/2 بافر تکثیر x10، µl 2 مخلوط dNTP 10 mM، mM 25MgCl µl 5/1، µl 75/0 از هر کدام از آغازگرها (μM 10) ، u1 آنزیم Pfu و µl16 آب انجام شد. برنامه حرارتی جهت انجام PCR شامل حرارت C˚ 94 به مدت 10 دقیقه (یک چرخه) برای شروع بود. مرحله دوم در قالب 32 چرخه شامل مراحل واسرشتگی در حرارت C˚ 94 به مدت 30 ثانیه، اتصال در C˚ 57 به مدت 30 ثانیه و بسط در C˚ 72 به مدت 30 ثانیه انجام شد. در پایان تکثیر نهایی به مدت 10 دقیقه در دمای C˚ 72 در یک چرخه انجام گردید. پس از انجام واکنش، محصول PCR بر روی ژل آگاروز 1% برده شده و پس از رنگ آمیزی با اتیدیوم بروماید محصولات توسط ژل نگار مشاهده و بررسی گردید. محصولات PCR ژن مورد نظر با استفاده از کیت خالص سازی شرکت فرمنتاز طبق دستور عمل العمل شرکت خالص سازی شدند.

کلونینگ ژن CagA  

جهت همسانه سازی قطعه ژن CagA در ناقل بیانی، ابتدا محصولات PCR خالص سازی شدند. ناقل pET32a با آنزیم‌های BamHI و EcoRI برش خورده و ناقل pET32a خطی شده از ژن استخراج شدند. در مرحله بعد واکنش الحاق بین ناقل  pET32a  و قطعه Cag A  هضم شده با آنزیم‌های ذکر
شده با استفاده از آنزیم T4 DNA لیگاز در دمای 8 درجه و به مدت 16 ساعت انجام گرفت و ناقل‌های حاصل از طریق ترانفورماسیون به میزبان اولیه جهت تکثیر اولیه (E. Coli DH5ɑ) وارد شدند. سپس استخراج پلاسمید از کلونی‌های رشد کرده توسط کیت استخراج پلاسمید متعلق به شرکت فرمنتاز انجام شد و صحت کلونیگ به روش کلونی PCR و هضم آنزیمی تایید گردید. برای بیان، پلاسمیدهای حامل ژن CagA (قطعه اپیتوپیک مورد نظر) به باکتری E.coli  سویهBL21 (DE3)  ترانسفورم شدند. صحت قالب خوانش ژن[1] به وسیله تعیین توالی و نرم افزار CLC Main Workbench 5 تایید شد.

بیان پروتئین نوترکیب

از کلونی‌هایBL21 (DE3)  حامل پلاسمیدهای pET32a-cagA در محیط LB براث حاوی آنتی بیوتیک‌های آمپی سیلین (17 میکرو لیتر از آمپی سیلین mg/ml100) کشت داده شد و 100 میکرولیتر از باکتری‌های کشت داده شده به 100 میلی لیتر از محیط القا اضافه و روی انکوباتور شیکر دار و در حرارت 37 درجه انکوبه گردید تا به جذب نوری 5/0 در طول موج 600 نانومتر (OD:600) رسید. در مرحله بعد القا به وسیله افزودن 100میکرولیتر IPTG[2] 1 مولار  انجام شد. در نهایت وزن مولکولی و محل قرار گرفتن پروتئین به دست آمده به وسیله آزمون SDS-PAGE [3] تایید شد (Sambrook et al). جهت بررسی محلولیت پروتئین نوترکیب، از محیط کشت باکتری القا شده با IPTG بعد از 4 ساعت انکوباسیون 1میلی لیتر برداشته و سلول‌ها با دور g8000 به مدت 3 دقیقه رسوب داده شد. رسوب حاصل در PBS x1 به خوبی حل شده و باکتری‌ها به روش سونیکاسیون (آمیلیفیکاسیون 80 و به مدت 10 دقیقه) سانترفیوژ شد و سپس محلول رویی و رسوب حاصل بر روی ژل 12 درصد SDS-PAGE الکتروفورز و با کوماسی بلو رنگ آمیزی شد.

نتایج

تعیین نواحی آنتی‌ژنیک ژن CagA

نتایج پیش بینی سرورهای بیوانفورماتیکی برای تعیین بخش‌های آنتی‌ژنیک ژن CagA نشان داد که فاصله نوکلئوتیدی 494 تا 1490 دارای بالاترین خاصیت آنتی‌ژنیک می‌باشد.

استخراج DNA و PCR

غلظت DNA استخراجی برابر با 300 نانوگرم بر میکرولیتر بود که نتایج الکتروفورز کیفیت مناسب DNA استخراجی را تایید کردند. محصول PCR با آنزیم pfu با اندازه قطعه مورد انتظار (996 جفت باز) همخوانی داشت و دمای مناسب برای اتصال 57 درجه در نظر گرفته شد (شکل 1).

AWT IMAGE

شکل 1. ژل آگاروز  1 درصد محصول PCR به طول 996

جفت بازمربوط به ژن Cag A

تعیین صحت همسانه سازی

AWT IMAGE

شکل 2. تائید قطعه همسانه شدی ،الکتروفورز ژل آگارز محصولات هضم پلاسمید نوترکیب با آنزیم های BamH I و .EcoR I ستون S1 ناقل هضم شده PET32-Cag A، ستون S2 ناقل هضم نشده PET32-Cag A

صحت همسانه سازی با هضم آنزیمی ناقل نوترکیب PET32/CagA با آنزیم‌های BamHI و EcoRI و انجام کلونی PCR با آغازگرهای promoter T7 و Tterminator تایید شد (شکل 2). تعیین توالی ناقل نوترکیب با آغازگرهای promoter T7 و Tterminator  نشان داد که قطعه هدف به درستی در ناقل پلاسمیدی کلون شده است و قالب خواندن آن (ORF) به طور صحیح پروتئین مربوطه را تولید می‌کند (شکل 3).

AWT IMAGE

شکل3. نقشه ناقل نوترکیب PET32-Cag A که با برنامه CLC Main Workbench رسم شده است.

بیان پروتئین CagA

بیان پروتئین نوترکیب با القا  IPTGو نمونه گیری در زمان‌های مختلف انجام شد و تولید پروتئین مورد نظر برای ژن CagA با وزن 57 کیلو دالتون با انجام SDS-PAGE تایید گردید (شکل 4). ناقل pET32 توالی تیوردوکسین را به پروتئین اضافه می‌کند که باعث انحلال پذیری پروتئین‌های دارای باند دی سولفیدی می‌شود اما نتایج نشان داد که پروتئین CagA به صورت نامحلول بوده و وزن ملکولی آن با اضافه شدن پروتئین تیرودوکسین توسط ناقل، 57 کیلودالتون است. همان طور که مشاهده می‌شود باند 57 کیلو دالتونی حاصل از بیان پروتئین در نمونه القا شده به خوبی قابل مشاهده می‌باشد.

بحث و نتیجه‌گیری

با توجه به دشوار بودن تشخیص بیماری‌های گوارشی در مراحل اولیه، مکانیزم دفاعی بدن در مقابل هلیکوباکتر پیلوری و مقاوم شدن این باکتری به درمان‌های آنتی بیوتیکی نیاز به درمان‌های اختصاصی و نوین برای مبارزه با این عفونت وجود دارد که یکی از آن‌ها تولید آنتی‌بادی اختصاصی می‌باشد. برای تولید آنتی‌بادی، انتخاب ایمونوژن اختصاصی برای پاتوژن مورد نظر الزامی ‌است (19). هلیکوباکترپیلوری می‌تواند پروتئین Cag A را از طریق ساختمان‌های ترشحی IV به داخل سلول‌های اپی‌تلیوم معده منتقل کند که پس از فسفوریله شدن توسط تیروزین، نقش مهمی در پاسخ سلول‌های میزبان، ایفاء می‌کند (20). بنابراین افراد آلوده به هلیکوباکتر پیلوری Cag A مثبت، مستعد ابتلا به زخم‌های معده، دوازدهه و سرطان معده می‌باشند. امروزه مطالعات جهت افزایش اختصاصیت و پیشگیری از بروز واکنش‌های متقاطع با سایر باکتری‌های فلور دستگاه گوارش بیشتر بر استفاده از آنتی‌ژن‌های خالص معطوف شده است بنابراین نیازمند آنتی‌ژن‌هایی از هلیکوباکترپیلوری با قدرت ایمنوژنسیته بالا برای کاهش عوارض جانبی و افزایش اختصاصیت هستیم (10) که از این میان پروتئین CagA هدف بالقوه مناسبی برای تولید آنتی بادی‌های اختصاصی می‌باشد. استفاده از اپی توپ‌های اصلی آنتی ژن به جای پروتئین کامل برای ایجاد تحریک ایمنی بسیار سودمند است و کوچک تر و اختصاصی‌تر شدن قطعه هدف باعث سهولت کار و احتمالا حفاظت بخشی بیشتر می‌شود. هرچند نمونه‌های دیگری از کلونیگ و بیان در مورد هلیکوباکتر پیلوری با استفاده از  ناقل‌های مختلف به انجام رسیده اما قطعه اپی توپیک انتخابی توسط ما تا کنون در هیچ پژوهش مشاهبی بررسی نشده است. در این پژوهش از نرم افزارهای آنلاین بیوانفورماتیکی برای شناسایی نواحی آنتی‌ژنیک ژن Cag A استفاده شد که حاصل آن انتخاب قطعه در فاصله نوکلئوتیدی 494 تا 1490 بود. پروتئین نوترکیب حاوی نواحی آنتی‌ژنیک ژن Cag A در

AWT IMAGE

شکل 4. بررسی بیان پروتئین نوترکیب با الکتروفورزSDS-PAGE  (ژل پایین 12% و ژل بالا 6% ) در ساعت‌های مختلف. حضور پروتئین  CagA  بر روی ژل کاملا مشخص است. وزن پروتئین Cag A نوترکیب 37 کیلو دالتون می باشد که با اضافه شدن پروتئین الحاقی در وزن 57 کیلو دالتون مشاهده می شود.

باکتری E.coli سویه BL21(D3) با وزن 57 کیلو دالتون تولید شد. ناقل PET-32 استفاده شده در این تحقیق به پروتئین Cag A یک پروتئین thioredoxin) Trx.tag) اضافه می‌کند که باعث پایداری پروتئین در سلول شده و از تخریب آن جلوگیری می‌نماید. در این مطالعه پروتئین CagA بیان شده در این ناقل PET32a کاملا به شکل نامحلول (Inclusion body) بود. فرجادی و همکاران نیز در سال 2013 نامحلول بودن این پروتئین را گزارش کردند (13). این موضوع می‌تواند به دلیل هدیروفوبیسیته بالا یا تشکیل ناقص باندهای دی سولفیدی در ساختار پروتئین باشد. نتایج بررسی میزان هیدروفوبیسیته این پروتئین با نرم افزار CLC Main Work bench5 نشان داده است که میزان هیدروفوبیسیته آن 463/0 می‌باشد که توجیه کننده عدم محلولیت آن نبود بنابراین این احتمالا تشکیل ناقص باندهای دی سولفیدی در ساختار پروتئین عامل ایجاد این مسئله باشد.

نتایج حاصل از بررسی حاضر نشان داد که ترکیب پروتئینی حاوی CagA به درستی تهیه شده است و این پروتئین به احتمال زیاد می‌تواند به عنوان کاندید مناسبی برای تولید واکسن و یک ابزار سرولوژیک برای شناسائی هلیکوباکتر پیلوری بوده و در طراحی کیت‌های تشخیصی مورد استفاده قرار بگیرد. علاوه بر این امکان استفاده از این پروتئین برای تولید ایمونوگلوبین Y ضد هلیکوباکتر پیلوری در زرده تخم مرغ و استفاده از آن به صورت خوراکی برای درمان بیماران مبتلا به این ارگانیسم وجود دارد که تایید این مسئله نیازمند مطالعات گسترده تر، ایمن سازی مرغ‌ها و بررسی پاسخ‌های ایمنی ناشی از آن می‌باشد.

تشکر و قدردانی

از کلیه پرسنل آزمایشگاه مرکزی بیمارستان قائم مشهد که در انجام این پژوهش نهایت همکاری را به عمل آوردند کمال تشکر و قدردانی را داریم.

تعارض منافع

نویسندگان هیچ گونه تعارض منافعی را اعلام نکرده اند.

References

1. Wroblewski LE, Peek RM, Wilson KT. Helicobacter pylori and gastric cancer: factors that modulate disease risk. Clinical microbiology reviews. 2010;23(4):713-39.

2. Cover T, Blaser M. Helicobacter pylori and gastroduodenal disease. Annual review of medicine. 1992;43(1):135-45.

3. Azizi F, Hatami H, Janghorbani M. Epidemiology and control of common diseases in Iran. Tehran: Eshtiagh Publications. 2000:602-16.

4. Blaser MJ. Who are we? Indigenous microbes and the ecology of human diseases. EMBO reports. 2006;7(10):956.

5. Yamaoka Y. Helicobacter pylori: molecular genetics and cellular biology: Horizon Scientific Press; 2008.

6. Brown LM. Helicobacter pylori: epidemiology and routes of transmission. Epidemiologic reviews. 1999;22(2):283-97.

7. Sadjadi A, Malekzadeh R, Derakhshan MH, Sepehr A, Nouraie M, Sotoudeh M, et al. Cancer occurrence in Ardabil: Results of a population‐based Cancer Registry from Iran. International journal of cancer. 2003;107(1):113-8.

8. Alborzi A, Soltani J, Pourabbas B, Oboodi B, Haghighat M, Hayati M, et al. Prevalence of Helicobacter pylori infection in children (south of Iran). Diagnostic microbiology and infectious disease. 2006;54(4):259-61.

9. Lax AJ. Bacterial toxins and cancer—a case to answer? Nature Reviews Microbiology. 2005;3(4):343-9.

10. Broutet N, Marais A, Lamouliatte H, de Mascarel A, Samoyeau R, Salamon R, et al. cagA Status and eradication treatment outcome of anti-Helicobacter pylori triple therapies in patients with nonulcer dyspepsia. Journal of clinical microbiology. 2001;39(4):1319-22.

 11. Mobley H, Island MD, Hausinger RP. Molecular biology of microbial ureases. Microbiol Ogical reviews.1995;59(3):451-80.

12. Klimovich AV, Samoylovich MP, Gryazeva IV, Terekhina LA, Suvorov AN, Klimovich VB. Development of Immunoreagents for Diagnostics of CagA‐Positive Helicobacter pylori Infections. Helicobacter. 2010;15(3):193-200.

13. Parsonnet J. Helicobacter pylori and gastric cancer. Gastroenterology Clinics of North America. 1993;22(1):89.

14. Czinn SJ, Cai A, Nedrud JG. Protection of germ-free mice from infection by Helicobacter felis after active oral or passive IgA immunization. Vaccine. 1993;11(6):637-42.

15. Queiroz DM, Silva CI, Goncalves MH, Braga-Neto MB, Fialho AB, Fialho AM, et al. Higher frequency of cagA EPIYA-C Phosphorylation Sites in H. pylori strains from first-degree relatives of gastric cancer patients. BMC gastroenterology. 2012;12(1):107.

16. Suarez G, Reyes VE, Beswick EJ. Immune response to H. pylori. World journal of gastroenterology: WJG. 2006;12(35):5593-8.

17. Suzuki H, Masaoka T, Miyazawa M, Suzuki M, Miura S, Ishii H. Gastric mucosal response to Helicobacter pylori. The Keio journal of medicine. 2002;51(supplement2):40-4.

18. Oluwasola A, Otegbayo J, Ola S, Ebili H, Afolabi A, Odaibo G. Correlation of Serum Anti-Helicobacter pylori Immunoglobulin A (IGA) with Histological Parameters of Chronic Gastritis in Ibadan, Nigeria. Annals of Ibadan Postgraduate Medicine. 2012;10(1):18-24.

19. Farjadi V, Abtahi H, Zolfaghari MR, Soufian S, Hasanzadeh L. Production of recombinant CagA protein of Helicobacter pylori. Arak Medical University Journal. 2013;16(7): p:37

20. Malaki P, latifi NS, Zahri S. Allelic Variation of Helicobacter pylori babY and cagA with clinical outcome, Review, GI. 2012; 17(4).


ارسال پیام به نویسنده مسئول

ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

CAPTCHA


XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Maleki M, Nassiri M R, Tahmoores pour3 M, Qazvini K. Cloning and Expression of Helicobacter Pylori CagA Gene Antigenic Regions in E. coli. J Fasa Univ Med Sci. 2016; 6 (1) :113-119
URL: http://journal.fums.ac.ir/article-1-811-fa.html

مالکی مهدیه، نصیری محمد رضا، طهمورث پور مجتبی، قزوینی کیارش. کلونینگ و بیان نواحی آنتیژنیک ژن CagA هلیکوباکتر پیلوری در باکتری اشرشیاکلی. مجله دانشگاه علوم پزشکی فسا. 1395; 6 (1) :113-119

URL: http://journal.fums.ac.ir/article-1-811-fa.html



دوره 6، شماره 1 - ( بهار 1395 ) برگشت به فهرست نسخه ها
Journal of Fasa University of Medical Sciences
Persian site map - English site map - Created in 0.06 seconds with 32 queries by YEKTAWEB 3903