[صفحه اصلی ]   [Archive] [ English ]  
:: صفحه اصلي :: درباره نشريه :: آخرين شماره :: تمام شماره‌ها :: ثبت نام :: تماس با ما ::
:: دوره 6، شماره 1 - ( بهار 1395 ) ::
جلد 6 شماره 1 صفحات 120-128 برگشت به فهرست نسخه ها
شیوع ژن های bla-SHV ، bla-TEM و bla-CTX-M و مقایسه الگوی مقاومت آنتی بیوتیکی در دو دسته کلبسیلا پنومونیه دارا و فاقد آنزیم های بتالاکتاماز وسیع الطیف در نمونه های بالینی بیمارستان های شهر کرمان
محمد مرادی1، امین نوروزی2، مجید طاعتی مقدم3
1- گروه میکروب شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران
2- کمیته تحقیقات دانشجویی، گروه میکروب شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران
3- کمیته تحقیقات دانشجویی، گروه میکروب شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی کرمان، کرمان، ایران ، majidtaati1367@yahoo.com
واژه‌های کلیدی: کلبسیلا پنومونیه، مقاومت آنتی بیوتیکی، ژن های بتالاکتاماز، PCR
متن کامل [PDF 968 kb]   (2570 دریافت)     |   چکیده (HTML)  (6435 مشاهده)
نوع مطالعه: پژوهشي | موضوع مقاله: ميكروبیولوژی
دریافت: ۱۳۹۴/۱/۱۹ | پذیرش: ۱۳۹۴/۸/۳۰ | انتشار: ۱۳۹۵/۳/۲۸
متن کامل:   (2918 مشاهده)

مقدمه

کلبسیلا‌ ها پاتوژن های فرصت طلبی از خانواده انتروباکتریاسه هستند که موجب سپتی سمی، باکتریمی، آنتریت نوزادان، مننژیت، عفونت های دستگاه ادراری و بافت های نرم می شوند. اهمیت کلبسیلا به عنوان پاتوژن انسانی در ایجاد عفونت های بیمارستانی بوده و بیماران بستری با نقص سیستم ایمنی و مبتلا به بیماری های زمینه ای از جمله دیابت ملیتوس، اختلالات ریوی مزمن، اهداف عمده این باکتری هستند (2،1). ازسال 1984 کلبسیلا پنومونیه به عنوان عامل عفونت های اکتسابی بیمارستانی و حامل مقاومت های چند گانه شناخته شده است (3). از طرفی مقاومت نسبت به آنتی بیوتیک ها درمیان باکتری های گرم منفی مانند کلبسیلا پنومونیه بالا می باشد که امروزه به عنوان یک مشکل در سراسر جهان مورد توجه قرار گرفته است. تعیین الگوی مقاومت آنتی بیوتیکی در باکتری های بیماریزای شایع جهت درمان علیه یک پاتوژن خاص حائز اهمیت است (4،6). استراتژی های مختلفی توسط باکتری ها به کار گرفته می شود تا از اثرات زیانبار آنتی بیوتیک ها مصون بمانند، یکی از این مکانیسم ها که در باکتری های گرم منفی علیه آنتی بیوتیک ها به کار گرفته می شود تولید آنزیم های بتالاکتامازی (Beta-Lactamase enzymes) است (5). مطالعات نشان می دهد که بیشترین مقاومت دارویی در بین باکتری های گرم منفی مانند اشرشیاکلی، کلبسیلا پنومونیه و سودوموناس آئروژینوزای ایجاد کننده­ی عفونت های بیمارستانی، عفونت های مجاری ادراری و باکتریمی دیده می شود که می توان علت عمده­ی آن را تولید آنزیم های بتالاکتاماز توسط این باکتری ها دانست (6). این آنزیم ها از طریق هیدرولیز حلقه بتالاکتام منجر به ایجاد مقاومت نسبت به این آنتی بیوتیک ها می شوند (7). اعضای خانواده انتروباکتریاسه بتالاکتامازهایی را تولید می نماید که توسط پلاسمید کد می شوند از نمونه این بتالاکتامازها می توان به  TEM،CTX-M  وSHV اشاره کرد. درمان عفونت های حاصل از باکتری های مولد این آنزیم ها بسیار مشکل است چون از یک سو مقاومت به طیف وسیعی از سفالوسپورین ها مشاهده می شود و از سوی دیگر بسیاری از ژن های ESBL برروی پلاسمیدهای بزرگی (بیش از 100کیلو باز) قرار دارد که هم زمان حامل ژن های مقاومت به سایر عوامل ضد میکروبی مثل آمینوگلیکوزیدها، کلرامفنیکل، سولفونامیدها وتتراسایکلین نیز است. این عفونت ها رابطه معنی داری با میزان مرگ و میر بیماران داشته  و بار مالی زیادی را در پی دارند (8). براساس عملکرد آنزیم های بتالاکتامازی در چهار گروه یا چهار کلاس اصلی A،B ،   Cوطبقه بندی می شوند. براساس این طبقه بندی، آنزیم های SHV, TEM و CTX-M در کلاس A قرار دارند (9). TEM امروزه به عنوان یکی از مهمترین مکانیسم های مقاومتی در برابر آنتی بیوتیک های خانواده بتالاکتام، در میان باکتری های گرم منفی مطرح می باشد (10).  بتالاکتاماز SHV برای نخستین بار توسط Pitton   در سال 1972 کشف و   PIT-2  نامگذاری شد که طبق تقسیم بندی Bush بتالاکتاماز کلاس A محسوب میگردد (11). ژن پیش ساز SHV  ممکن است به صورت یک ژن کروموزومی در سویه های کلبسیلا ظاهر شده و سپس از راههای مختلف ژنتیکی به پلاسمید منتقل شده و از آن طریق در بین گونه های دیگر انتروباکتریاسه پخش شده باشد(12).

خانواده CTX-M از بتالاکتامازهای وسیع الطیف در سال 1989 برای اولین بار از آلمان گزارش شدند و پس از آن در نقاط مختلف دنیا گسترش یافتند. این آنزیم ها عمدتأ در خانواده انتروباکتریاسه وجود دارند (13). بتالاکتامازهای CTX-M ارتباطی با بتالاکتامازهای TEM یا HSV  ندارند، و تنها %14 با این دو بتالاکتاماز شباهت دارند. برخلاف بتالاکتامازهای TEM و SHV بتالاکتامازهای  CTX-Mاثر هیدرولیز کنندگی بیشتری برروی آنتی­بیوتیک های سفوتاکسیم و سفتریاکسون نسبت به سفتازیدیم دارند (14).

با افزایش مقاومت گونه­های کلبسیلا پنومونیه به آنتی بیوتیک ها ، هدف از این مطالعه بررسی میزان شیوع ژن های مقاومتی bla-SHV، bla-TEM و bla-CTX-M در نمونه های بالینی(زخم، سوختگی، ادرار، تراشه، خلط وسایر مایعات) و ارتباط این گونه ها با میزان مقاومت می باشد.

مواد و روش ها

شناسایی باکتری: جمع آوری 111 نمونه ی کلبسیلا پنومونیه از بیمارستان های افضلی پور، شفا، باهنر وسیدالشهدای شهر کرمان از خرداد تا بهمن سال 1392 انجام گرفت و نمونه ها از زخم، سوختگی، ادرار، تراشه، خلط وسایر مایعات بدن جداسازی شد و به بخش میکروب شناسی دانشکده پزشکی دانشگاه کرمان انتقال داده شد وسپس با توجه به روش های استاندارد تشخیصی و بیوشیمیایی تعیین گونه گردیدند. پس از  24- 48 ساعت گرمخانه گذاری در دمای 37 درجه سانتی گراد، برای کلنی هایی که ویژگی های کلنی کلبسیلا پنومونیه را داشتند تستهای بیوشیمیایی افتراقی شاملTSI ،  SIM، MR-VP، سیترات، اوره در آزمایشگاه گروه میکروب شناسی صورت گرفت و باکتری کلبسیلا پنومونیه جداسازی شد.

تست تعیین حساسیت دارویی (آنتی بیوگرام): الگوی مقاومت آنتی بیوتیکی باکتری های جداشده به روش استاندارد دیسک CLSI (Clinical and laboratory standard institute) دیفیوژن انجام شد وآنتی بیوتیک های مورد استفاده شامل دیسک های ایمی پنم(µg10)، سفتازیدیم (µg30)، جنتامایسین (µg10)، کلرامفنیکل(µg30)، نالیدیکسیک اسید(µg30)، کوتریموکسازول(µg75/23/25/1)، سفتریاکسون(µg30)، تتراسایکلین(µg30)، آزترونام(µg30)، سفوتاکسیم(µg30) ، آمپی سیلین(µg10)، آمیکاسین(µg30)، سفالوتین(µg30) وسیپروفلوکساسین(µg5) بودند که از شرکت Himedia هند خریداری شد.

شناسایی بتالاکتامازهای وسیع الطیف (ESBLs): برای شناسایی ایزوله های تولید کننده ESBLs از تست تاییدی فنوتیپی شامل دیسک های ترکیبی سفتازیدیم/کلاولانیک اسید در  مقایسه  با   سفتازیدیم  و  سفوتاکسیم/کلاولانیک اسید در
مقایسه با سفوتاکسیم استفاده شد. بعد از انکوباسیون به مدت 24 ساعت در 37 درجه سانتی گراد نمونه های تولیدکننده ESBLs دارای قطر هاله عدم رشد به اندازه 5 میلیمتر یا بیشتر در اطراف دیسکهای سفتازیدیم /کلاولانیک اسید در مقایسه با سفتازیدیم و یا سفوتاکسیم /کلاولانیک اسید در مقایسه با سفوتاکسیم بودند.

جدول 1. پرایمر ژن های بیماری زا

باند محصول(bp)

  1. '-3') توالی پرایمر

F- TCAGCGAAAAACACCTTG

R- TCCCGCAGATAAATCACC

F- GAGTATTCAACATTTCCGTGTC

R- TAATCAGTGAGGCACCTATCTC

F- CGCTTTGCGATGTGCAG

R- ACCGCGATATCGTTGGT

پس از تعیین ایزوله هایی که از نظر فنوتیپی مثبت بودند، DNA نمونه های شناسایی شده به عنوان ESBLs با استفاده از روش جوشاندن جداسازی شد که در این روش مقداری از کلنی های باکتری کلبسیلا پنومونیه را به داخل یک اپندورف حاوی 1 میلی لیتر آب مقطر انتقال دادیم و یک سوسپانسیون بوجود آوردیم و سپس اپندورف حاوی سوسپانسیون به مدت 10 دقیقه در آب جوش قرار دادیم و بعد از آن در دستگاه سانتریفیوژ با دور 12000 به مدت 7 دقیقه سانتریفیوژ کردیم، محلول رویی حاوی DNA مورد نظر بوده که جهت انجام PCR استفاده گردید.

شناسایی ژن های bla-SHV، bla-TEM و bla-CTX-M: جهت شناسایی ژن­های bla-SHV، bla-TEMو bla-CTX-M ایجاد کننده مقاومت در نمونه های کلبسیلا پنومونیه از روش PCR استفاده کردیم دراین روش با استفاده از کیت Master mix (شرکت آمپیکون دانمارک) PCR را انجام دادیم. توالی پرایمرهای مورد استفاده و همچنین اندازه باندهای محصولات بر روی ژل اکتروفورز بر اساس رفرنس در جدول 1 ذکر گردیده است. جهت انجام PCR در حجم نهایی 25 میکرولیتر در لوله های اپندروف از مخلوط کردن 5/12میکرولیتر مسترمیکس، 3 میکرولیتر از DNA باکتری،  pmol 10 از پرایمر و آب مقطر استریل استفاده شد و همچنین واکنش PCR طبق برنامه زیر انجام گردید (28). پس از انجام آزمایش PCR محصولات PCR را در ژل %5/1در TBE بافر به مدت 60 دقیقه در ولتاژ 90 الکتروفورز کردیم. برای رنگ آمیزی ژل، آن را به مدت 15 دقیقه در تانک حاوی اتیدیوم بروماید قرار دادیم و سپس نتایج توسط دستگاه Geldocument بانور UV مشاهده شدند. . از سویه کلبسیلا پنومونیه ATCC 700603 به عنوان سویه کنترل مثبت تولید کننده ژن bla-SHVوbla-CTX-M و از سویه اشریشیاکلی ATCC 35218 به عنوان کنترل مثبت ژن bla-TEM استفاده کردیم و همچنین از سویه اشرشیا کلی ATCC 25922 به عنوان سویه کنترل منفی در این مطالعه استفاده شد.

نتایج

با توجه به جدول 2،  بیشترین   مقاومت  به نسبت به آنتی بیوتیک آمپی سیلین مشاهده شد که %5/92  از نمونه ها کلبسیلا پنومونیه مقاوم به این آنتی بیوتیک بودند از طرفی درصد مقاومت به آنتی بیوتیک های سفوتاکسیم، سفتازیدیم، سفتریاکسون، آزترونام، سفالوتین و کوتریموکسازول در مقایسه با سایر آنتی بیوتیک ها بیشتر بوده است که مقاومت به تمامی این آنتی بیوتیک ها بالای %50 می باشد. موثرترین آنتی بیوتیک علیه نمونه های کلبسیلا پنومونیه آنتی بوتیک ایمی پنم بود که حساسیت به این آنتی بیوتیک 89 درصد می باشد و تنها %2/7 از کل نمونه ها به این آنتی بیوتیک کقاوم بودند علاوه بر آن درصد بالایی از نمونه های کلبسیلا پنومونیه به آنتی بیوتیک های جنتامایسین، کلرامفنیکل، افلوکساسین، تتراسایکلین، سیپروفلوکساسین و آمیکاسین حساس بودند که میزان حساسیت به آنتی بیوتیک های کلرامفنیکل، افلوکساسین، سیپروفلوکساسین و آمیکاسین بالای %70  و برای آنتی بیوتیک های تتراسایکلین و جنتامایسین تقریبا بالای %60 می باشد. جدول 2 جزئیات بدست آمده از نتایج آنتی بیوگرام را نشان می دهد. نتایج دیسک های ترکیبی جهت شناسایی فنوتیپی ایزوله های کلبسیلا پنومونیه نشان دادند که

جدول 2. درصد مقاومت وحساسیت نمونه های کلبسیلا پنومونیه

آنتی بیوتیک

حساس (S)

نیمه حساس (I)

مقاوم (R)

آمپی سیلین

9/1 %

5/5 %

5/92 %

آمیکاسین

4/68 %

7/11 %

8/19 %

کوتریموکسازول

45 %

7/2 %

2/52 %  

نالیدیکسیک اسید

9/72 %

8/10 %

2/16 %

افلوکساسین

4/77 %

9/0 %

6/21 %

کلرامفنیکل

2/72 %

1/8 %

6/21 %

آزوترونام

7/47 %

0/0 %

2/52 %

جنتامایسین

4/59 %

0/0 %

5/45 %

تتراساکلین

3/69 %

4/5 %               

2/25 %

سفتریاکسون

45 %

0/0 %

9/54 %

سفتازیدیم

9/46 %

0/0 %

53 %

سفالوتین

2/39 %

1/1 %

5/59 %

سیپروفلوکساسین

4/79 %

5/3 %

9/16 %

ایمی پنم

1/89 %

6/3 %

2/7 %

جدول3. درصد مقاومت به آنتی بیوتیک های مختلف در مقایسه با نمونه های تولید کننده ESBLs و نمونه های فاقد ESBLs

آنتی بیوتیک

نمونه های فاقد ESBLs

نمونه های دارای ESBLs

آمپی سیلین

5/86 %

3/98 %

آمیکاسین

8/3 %

2/32 %

کوتریموکسازول

3/15 %

6/79 %

نالیدیکسیک اسید

6/7 %

5/27 %

افلوکساسین

8/3 %

2/37 %

کلرامفنیکل 

3/15 %

1/27 %

آزوترونام

9/1 %

6/96 %

جنتامایسین

0/0 %

2/76 %

تتراساکلین

5/11 %

2/37 %

سفتریاکسون

7/5 %

3/98 %

سفتازیدیم

0/0 %

5/95 %

سفالوتین

5/19 %

8/97 %

سیپروفلوکساسین

9/1 %

5/30 %

ایمی پنم

0/0 %

5/13 %

تعداد 59 (1/53 %) نمونه به طور فنوتیپی دارای آنزیم های ESBLs بودنند اما بعد از انجام PCR تعداد 56 (4/50 %) سویه دارای ژن های bla-SHV، bla-TEM و bla-CTX-M بودند.

AWT IMAGE

شکل 1. نشان دهنده وجود ژن bla TEM ( bp861) و bla-CTXM (550 bp) می‌باشد. چاهک شماره 1 مارکر (bp1500-100) ، چاهک شماره 4 سویه کنترل منفی، چاهک شماره 7 سویه کنترل مثبت و چاهک شماره2، 3، 5  و 8 نمونه های بالینی دارای ژن های bla-TEM و bla-CTXM می باشند. از سویه کلبسیلا پنومونیه ATCC 700603 به عنوان سویه کنترل مثبت تولید کننده ژن  bla CTXMو از سویه اشریشیاکلی ATCC 35218 به عنوان کنترل مثبت ژن bla TEM و همچنین از سویه اشرشیا کلی ATCC 25922 به عنوان سویه کنترل منفی استفاده شدند.

 که از این تعداد 43 (7/76 %) سویه دارای ژن bla-TEM و 52 (8/92 %) سویه دارای ژن های   bla-CTX-M و 54 (4/96 %) دارای ژن bla-SHV بودند و تعداد 33 (9/58 %) سویه دارای هر ژن bla-SHV، bla-TEM و bla-CTX-M بودند.

AWT IMAGE

شکل 2. نشان دهنده باندهای ژن bla-SHV ( bp471) می باشد،  چاهک شماره 1 مارکر (bp1500-100)، چاهک شماره 2 سویه کنترل مثبت و شماره 3 سویه کنترل منفی و چاهک شماره های 8-6 نمونه های بالینی دارای ژن bla-SHV می باشند. از سویه کلبسیلا پنومونیه ATCC 700603 به عنوان سویه کنترل مثبت تولید کننده ژن  bla-SHV و از سویه اشرشیا کلی ATCC 25922 به عنوان سویه کنترل منفی استفاده شدند.

54 (4/96 %) دارای ژن bla-SHV بودند و تعداد 33 (9/58 %) سویه دارای هر ژن bla-SHV، bla-TEM و bla-CTX-M بودند. شکل شماره یک و دو نشان دهنده وجود ژن بر روی

ژل آگاروز می باشد. در این مطالعه نیز نتایج آنتی بیوگرام نشان داد که میزان مقاومت به تمامی آنتی بیوتیک ها در نمونه هایی که تولید کننده ESBLs می باشد بیشتر از نمونه هایی می باشد که فاقد ESBLs می باشند (جدول 3).

بحث و نتیجه گیری

کلبسیلا پنومونیه از باکتر ی­های گرم منفی می باشد که از نظر کلینیکی نقش مهمی در ایجاد عفونت بیمارستانی و عفونت مجاری ادراری ایفا می کند. متاسفانه مصرف بی رویه ی آنتی بیوتیک ها در دهه های اخیر موجب افزایش ظهور سویه های مقاوم با مقاومت چند گانه ی دارویی در باکتر ی های روده ای گرم منفی از جمله کلبسیلا پنومونیه شده است، به طوری که این باکتری ها با تولید آنزیم های بتالاکتاماز وسیع الطیف یا ESBLs نسبت به آنتی بیوتیک هایی نظیر سفالوسپورین، پنی سیلین، سیپروفلوکساسین و سفوتاکسیم مقاومت نشان میدهند و وجود ژن کد کننده ی آنزیم های بتالاکتامازی و انتقال آن در بین باکتری های گرم منفی روده ای یک تهدید بزرگ برای مصرف کنندگان سفالوسپورین های با طیف وسیع به شمار می آیند (16-19). در این مطالعه مقاومت به آنتی بیوتیک های سفوتاکسیم، سفتازیدیم، سفتریاکسون، آزترونام، سفالوتین، و کوتریموکسازول بخصوص آمپی سیلین در سطح بالایی وجود داشت که مقاومت به این شش آنتی بوتیک بالای %50 بود که در آینده میتواند این مقاومت ها بیشتر شده و ایجاد مشکلاتی در درمان کند، از طرفی حدود %90 سویه ها به ایمی پنم حساس بودند. مطالعات زیادی در ایران انجام شده است که تایید کننده نتایج بدست آمده از این مطالعه می باشد در مطالعه ای  که مشعوف و همکاران در همدان انجام دادند موثرترین آنتی بیوتیک علیه ایزوله های کلبسیلا پنومونیه آنتی بیوتیک ایمی پنم اعلام شد و با اینکه مقاومت به این آنتی بیوتیک در اکثر مطالعات بسیار پایین می باشد اما باید توجه داشت از مصرف بی رویه این آنتی بیوتیک در درمان جلوگیری کنیم تا مقاومت به این آنتی بیوتیک افزایش نیابد. همچنین در مطالعه ای که توسط فیض آبادی و همکاران انجام شد تمامی ایزوله های کلبسیلا پنومونیه به آنتی بیوتیک ایمی پنم حساس بودند و مقاومت به سیپروفلوکساسین و افلوکساسین در سطح پایینی وجود داشت اما مقاومت به سفالوسپورین ها در سطح بالایی وجود داشت این نتایج با نتایج بدست امده از مطالعه ما مطابقت دارد (20،21).

برخی از مطالعات در باکتری های مختلف نشان میدهد که مقاومت به اکثر آنتی بیوتیک ها نظیر کینولون ها، فلوروکینولون ها و بتالاکتام ها، در سویه های تولید کنند ESBL بیشتر از سویه های فاقد ESBL است (20) در این مطالعه نیز نتایج آنتی بیوگرام نشان داد که میزان مقاومت به تمامی آنتی بیوتیک ها در نمونه هایی که تولید کننده ESBLs می باشد بیشتر از نمونه هایی می باشد که فاقد ESBLs می باشند.

همچنین در این مطالعه از 111 نمونه کلبسیلا پنومونیه بیشتر از 50 درصد نمونه تولید کننده آنزیم های وسیع الطیفESBLs  بودند که تعداد 56 (4/50) سویه دارای ژن های bla-SHV، bla-TEM و bla-CTX-M بودند و در میان ژن های ESBLs بیشترین شیوع را ژن bla-SHV در بین سویه های کلبسیلا پنومونیه به خود اختصاص داده است این در حالی است که مشعوف و همکاران در سال 1392 در همدان نشان دادند که میزان شیوع کلبسیلا پنومونیه های تولید کننده ESBLs %7/46 می باشد (20). این میزان شیوع بالای ژن های ESBLs توجیه کننده مقاومت بالا به آنتی بیوتیک های بتالاکتام و سفالوسپورین های نسل سوم می باشد که متاسفانه تولید میزان بالای ESBLs نشان دهنده این موضوع است که سویه های کلبسیلا پنومونیه تولید کننده آنزیم ها بتالاکتاماز وسیع الطیف در طی این سال ها رو به افزایش بوده اند. مطالعات مشابه زیادی در ایران و سایر نقاط جهان در زمینه کلبسیلا پنومونیه تولید کننده ESBLs صورت گرفته است که تایید کننده اطلاعات به دست آمده از این مطالعه می باشد که می توان به مطالعه ای که در سال 1389 در تهران بر روی 104 نمونه کلبسیلا پنومونیه توسط فیض آبادی و همکاران مورد بررسی قرار گرفت اشاره کرد که %1/72 از این نمونه ها تولید کننده ESBLs بودند که این اعداد نشانگر درصد بالای ESBLs در کشور ما می باشد (21). از طرفی میرصالحیان  و همکاران گزارش دادند که تولید ESBLs در سویه کلبسیلا پنومونیه در
تهران به %76 رسیده است (22). همچنین مطالعه ای که در ترکیه توسط Aladag و همکاران بر روی 87 سویه  کلبسیلا پنومونیه صورت گرفت نشان داد که %44 از این سویه ها دارای ESBLs بودند (23).Patzer  و همکاران نیز در %56 از سویه های کلبسیلا پنومونیه، ژن SHV-1 را گزارش کردند (24).  Song و همکاران در مطالعه ای نشان دادند که 80 نمونه کلبسیلا پنومونیه دارای ژن TEM-1 و 40 نمونه ژن SHV-1 را دارا می باشند (25).

در مطالعه ای که Aamer و همکاران در سال 2003 بر روی نمونه های کلبسیلا پنومونیه تولید کننده ESBLs انجام دادند %52 از این سویه ها تولید کننده این آنزیم ها می باشند (27). با توجه به گزارشات فوق میزان شیوع ESBL در سویه های کلبسیلا پنومونیه در شهر کرمان مشابه با برخی نقاط جهان و ایران می باشد ولی این شیوع، با بسیاری از نقاط جهان و حتی ایران متفاوت است.

با بررسی فوق و نتایج مشابه توسط سایر محققان میتوان به این نتیجه رسید که مصرف بی رویه آنتی بیوتیک ها باعث مقاومت باکتری ها به آنتی بیوتیک ها می شود و ژن های مقاومت به طور سریع تر در بین باکتری های پاتوژن انتقال می یابند. بنابراین پیشنهاد میشود با مطالعه در زمینه ی شیوع مقاومت ها و انتقال ژن های بیماریزا در باکتری ها بتوان از مصرف بی رویه این آنتی بیوتیک ها جلوگیری به عمل آورد و همچنین با رعایت بهداشت بیماران و تغییر استراتژی مصرف آنتی بیوتیک، شرایطی مناسب را در بخش هایی که بیماران در آن به مدت طولانی بستری هستند مهیا کرد و تا حدی از انتقال این مقاومت ها جلوگیری نمود.

تشکر و قدردانی

در این مطالعه مراتب قدردانی و تشکر خود را از کمیته تحقیقات دانشجویی دانشگاه علوم پزشکی کرمان به دلیل حمایت های  مالی و اجرایی اعلام می‌داریم.

تعارض منافع

نویسندگان هیچ گونه تعارض منافعی را اعلام نکرده‌اند.

References

1.  Babypadmini S, Appalaraju B. Extended spectrum-lactamases in urinary isolates of Escherichia coli and Klebsiella pneumoniae-Prevalence and susceptibility pattern in a tertiary care hospital. Indian J Med Microbiol. 2004;22(3):172.

2. Mahmood A, Al Hakawati MI. Non-beta-lactam Antimicrobials versus Extended Spectrum Beta-lactamase Producing Gram Negative Bacteria: In vitro Susceptibility Study. Infect Dis Soc of Pak. 2011;43(5)507-511.

3. Podschun R, Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev. 1998;11(4):589-603.

4. Tankhiwale SS, Jalgaonkar SV, Ahamad S, Hassani U. Evaluation of extended spectrum beta lactamase in urinary isolates. Indian J Med Res. 2004;120(6):553-556.

5. Cryz S, Fürer E, Germanier R. Safety and immunogenicity of Klebsiella pneumoniae K1 capsular polysaccharide vaccine in humans. J Infect Dis. 1985;151(4):665-671.

6. Silvestri L, van Saene H. Hospital-acquired infections due to gram-negative bacteria. N Engl J Med. 2010;363(15):1482-1486.

7. Perilli M, Celenza G, De Santis F, Pellegrini C, Forcella C, Rossolini GM, et al. E240V substitution increases catalytic efficiency toward ceftazidime in a new natural TEM-type extended-spectrum beta-lactamase, TEM49, from Enterobacter aerogenes and Serratia marcescens clinical isolates. Antimicrob Agents Chemother. 2008;52(3):915-919.

8. Sturenburg E, Mack D. Extended spectrum beta-lactamases: implication for the clinical microbiology, therapy and infection control. J Infect 2003;47(4):273-295.

9. Bush K, Jacoby GA, Medeiros AA. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother. 1995;39(6):1211-1233.

10. Chaves J, Ladona MG, Segura C, Coira A, Reig R, Ampurdanes C. SHV-1 beta- lactamase is mainly a chromosomally encoded speciesspecific enzyme in Klebsiella pneumoniae. Antimicrob Agents Chemother. 2001; 45: 2856-2861.

11. Liver more DM. Beta – lactamase in laboratory and clinical resistance. Clin Microbiol Rev. 1995;8(4):557 – 584.

12. Miranda G, Castro N, Leanos B, Valenzuela A, Garza-Ramos U, Rojas T, et al. Clonal and horizontal dissemination of Klebsiella pneumoniae expressing SHV-5 extended spectrum beta-lactamase in a Mexican pediatric hospital. J Clin Microbiol. 2004; 42(1): 30-35.

13. Ishii Y, Ohno A, Taguchi H, Imajo S, Ishiguro M, Matsuzawa H. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A betalactamase isolated from Escherichia coli. Antimicrob Agents Chemother. 1995; 39(10): 2269-2275.

14. Tzouvelekis LS, Tzelepi E, Tassios PT, Legakis NJ. CTX-M-type betalactamases: an emerging group of extended-spectrum enzymes. Int J Antimicrob Agents. 2000;14(2):137-142.

15. Zaniani FR, Meshkat Z, Nasab MN, Khaje-Karamadini M, Ghazvini K, Rezaee A, et al. The Prevalence of TEM and SHV Genes among Extended-Spectrum Beta-Lactamases Producing Escherichia Coli and Klebsiella Pneumoniae. Iran J Basic Med Sci. 2012;15(1):654-660.

16. Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2001; 65(2): 232-260.

17. Peleg AY, Hooper DC. Hospital-acquired infections due to gram-negative bacteria. N Engl J Med. 2010; 362(19): 1804-1813.

18. Paterson DL, Ko W-C, Von Gottberg A, Mohapatra S, Casellas JM, Goossens H, et al. International prospective study of Klebsiella pneumoniae bacteremia: implications of extended-spectrum β-lactamase production in nosocomial infections. Annals of internal medicine. 2004;140(1):26-32.

19. Subha A, Ananthan S. Extended spectrum beta lactamase (ESBL) mediated resistance to third generation cephalosporins among Klebsiella pneumoniae in Chennai. Indian J Med Microbiol. 2002; 20(2): 92-95.

20. Mashouf RY, Alijani P, Saidijam M, Alikhani M, Rashidi H. Study of Antibiotic Resistance Pattern and Phenotypic Detection of ESBLs in Klebsiella Pneumoniae Strains Isolated from Clinical Samples and Determination of Minimum Inhibitory Concentrations of Imipenem and Ceftazidim Antibiotics. Scientific J Hamadan Univ Med Sci. 2014;4(70):295-302.

21. Feizabadi MM, Mahamadi-Yeganeh S, irsalehian A, Mirafshar S-M, Mahboobi M, Nili F, et al. jenetic characterization of ESBL producing strains of Klebsiella pneumoniae from Tehran hospitals. J Infect Dev Ctries. 2010;4(10):609-615.

22. Mirsalehan A, et al. Prevalence of Extended Spectrum β-Lactamase-Producing Enterobacteriaceae by Phenotypic and Genotypic Methods in Intensive Care Units in Tehran, Iran. DARU. 2008;16(3)169-173.

23. Aladag MO, Durak Y, Uysal A. Investigation of imipenem and meropenem suseeptibilties, plasmid profiles and ESBL characteristic of klebsiella pneumoniae. Isolated from urinary tract infections. World Appl Sci J. 2009; 7(3): 378-381.

24. Patzer JA, Dzierzanowska D, Pawinska A, Turner PJ. High activity of meropenem against Gram-negative bacteria from a paediatric Intensive Care Unit, 2001-2005. Int J Antimicrob Agents. 2007; 29(3): 285-288.

25. Song W, Bae IK, Lee YN, Lee CH, Lee SH, Jeong SH. Detection of extended-spectrum betalactamases by using boronic acid as an AmpC beta-lactamase inhibitor in clinical isolates of Klebsiella spp. and Escherichia coli. J Clin Microbiol. 2007; 45(4): 1180-1184.

26. Dutour C, Bonnet R, Marchandin H, Boyer M, Chanal C, Sirot D, et al. CTX-M-1, CTX-M-3, and CTX-M-14 β-lactamases from Enterobacteriaceae isolated in France. Antimicrob. Agents Chemother. 2002;46(2):534-537.

27. Aamer A, Fariha H, Safia A. Prevalance of extended-spectrum β-lactamase in nosocomial and outpatient. Pak J Med Sci. 2003; 9(3):187-191.

28. Pakzad I, Ghafourian S, Taherikalani M. Qnr prevalence in extended spectrum beta-lactamases (ESBLs) and none-ESBLs producing Escherichia coli isolated from urinary tract infections in central of Iran. Iran J Basic Med Sci. 2011;14(5):458-464.

ارسال پیام به نویسنده مسئول

ارسال نظر درباره این مقاله
نام کاربری یا پست الکترونیک شما:

CAPTCHA


XML   English Abstract   Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Moradi M, Norouzi A, Taati moghadam M. Prevalence of bla-CTX-M, bla-SHV, and bla-TEM Genes and Comparison of Antibiotic Resistance Pattern in Extended-spectrum β-lactamase producing and non-producing groups of Klebsiella pneumoniae Isolated from Clinical Samples in Kerman Hospitals. J Fasa Univ Med Sci. 2016; 6 (1) :120-128
URL: http://journal.fums.ac.ir/article-1-862-fa.html

مرادی محمد، نوروزی امین، طاعتی مقدم مجید. شیوع ژن های bla-SHV ، bla-TEM و bla-CTX-M و مقایسه الگوی مقاومت آنتی بیوتیکی در دو دسته کلبسیلا پنومونیه دارا و فاقد آنزیم های بتالاکتاماز وسیع الطیف در نمونه های بالینی بیمارستان های شهر کرمان. مجله دانشگاه علوم پزشکی فسا. 1395; 6 (1) :120-128

URL: http://journal.fums.ac.ir/article-1-862-fa.html



دوره 6، شماره 1 - ( بهار 1395 ) برگشت به فهرست نسخه ها
Journal of Fasa University of Medical Sciences
Persian site map - English site map - Created in 0.06 seconds with 32 queries by YEKTAWEB 3921